splashRNA

Input in FASTA format

# Entries can contain entrezid refseqid or a gene sequence > entrezID 71458 > refseqID NM_001127233.1 > Sequence ATGTAAATAACTTTAATAAAACGTTTATAGCAGTTACACAGAATTTCAATCCTAGTATATAGTACCTAGT

Predictions per gene:

Remove constructs with EcoRI or Xho sites

Sequence before most proximal poly-A site (for Entrez IDs)

Coding sequences only (for Entrez IDs)

Show predictions present multiple times in the same gene

Show predictions present in other genes (off-targets)

I am a non-profit, academic user E-mail

Please cite:
Pelossof, Fairchild, et al. "Prediction of potent shRNAs with a sequential classification algorithm." Nature Biotechnology. 2017 Apr;35(4):350-353. http://dx.doi.org/10.1038/nbt.3807

If you would like to purchase SplashRNA predicted shRNA constructs or ready-to-use libraries, please contact the MSKCC Gene Editing and Screening Core Facility.

splashRNA

Input in FASTA format

Advanced Parameters